5'-Levulinyl and 2'-tetrahydrofuranyl protection for the synthesis of oligoribonucleotides by the phosphoramidite approach.

AUTOR(ES)

Iwai, S

RESUMO

The levulinyl group has been employed for protection of the 5'-hydroxyl group in the synthesis of oligoribonucleotides by the phosphoramidite approach, using the acid-labile 2'-tetrahydro-furanyl group. The hydrazine treatment was performed for 10 minutes in order to remove the levulinyl group on controlled pore glass. Four decaribonucleotides (AAAAAAAAAU, GGGGGGGGGU, CCCCCCCCCU and UUUUUUUUUU) and a heneicosamer (GCCUAGCUGAUGAAGGGUGAU) were prepared with an automatic synthesizer in good yields.

Documentos Relacionados

• Large scale, liquid phase synthesis of oligonucleotides by the phosphoramidite approach.
• Solid phase synthesis of oligoribonucleotides using o-nitrobenzyl protection of 2'-hydroxyl via a phosphite triester approach.
• A new solid-phase synthesis of oligoribonucleotides by the phosphoro-p-anisidate method using tetrahydrofuranyl protection of 2'-hydroxyl groups.
• Solid phase synthesis of oligoribonucleotides using the 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (Ctmp) group for the protection of the 2'-hydroxy functions and the H-phosphonate approach.
• Evaluation of 2'-hydroxyl protection in RNA-synthesis using the H-phosphonate approach.