Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.
AUTOR(ES)
Wuerffel, R A
RESUMO
We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.
ACESSO AO ARTIGO
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=362277Documentos Relacionados
- Effect of ciprofloxacin on mitogen-stimulated lymphocyte proliferation.
- Inactivated bovine herpesvirus 1 induces apoptotic cell death of mitogen-stimulated bovine peripheral blood mononuclear cells.
- Dysfunctions of Pokeweed Mitogen-stimulated T and B Lymphocyte Responses Induced by Gammaglobulin Therapy
- Prostaglandin Suppression of Mitogen-Stimulated Lymphocytes In Vitro: CHANGES WITH MITOGEN DOSE AND PREINCUBATION
- Detection of a novel minisatellite-specific DNA-binding protein.