Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.
AUTOR(ES)
Osuna, R
RESUMO
Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.
ACESSO AO ARTIGO
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=196741Documentos Relacionados
- In vitro transcription of the histidine utilization (hutUH) operon from Klebsiella aerogenes.
- Regulation of hutUH operon expression by the catabolite gene activator protein-cyclic AMP complex in Klebsiella aerogenes.
- Roles of catabolite activator protein sites centered at -81.5 and -41.5 in the activation of the Klebsiella aerogenes histidine utilization operon hutUH.
- Bidirectional promoter in the hut(P) region of the histidine utilization (hut) operons from Klebsiella aerogenes.
- Regulation of the hut operons of Salmonella typhimurium and Klebsiella aerogenes by the heterologous hut repressors.
