Rous sarcoma virus genome is terminally redundant: the 3' sequence.
AUTOR(ES)
Schwartz, D E
RESUMO
A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
ACESSO AO ARTIGO
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=430560Documentos Relacionados
- Rous sarcoma virus genome is terminally redundant: the 5' sequence.
- The genome of frog virus 3, an animal DNA virus, is circularly permuted and terminally redundant.
- Intronic sequences and 3' splice sites control Rous sarcoma virus RNA splicing.
- Multiple enhancer domains in the 3' terminus of the Prague strain of Rous sarcoma virus.
- The nucleotide sequence of an untranslated but conserved domain at the 3' end of the avian sarcoma virus genome.