Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.
AUTOR(ES)
Frayne, E G
RESUMO
Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element.
ACESSO AO ARTIGO
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=339849Documentos Relacionados
- Nucleotide sequence of chicken myb proto-oncogene promoter region: detection of an evolutionarily conserved element.
- Characterization of the mouse beta maj globin transcription termination region: a spacing sequence is required between the poly(A) signal sequence and multiple downstream termination elements.
- A conserved DNA structural control element modulates transcription of a mammalian gene.
- Identification of a new promoter upstream of the murine dihydrofolate reductase gene.
- Replication in the amplified dihydrofolate reductase domain in CHO cells may initiate at two distinct sites, one of which is a repetitive sequence element.
