The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

AUTOR(ES)

Takaiwa, F

RESUMO

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-GCGGAAAAAUAGCUCGAUGCCAGGAUAOH. This 5S rRNA shows high sequence homology with those from chloroplasts of flowering plants and from a blue-green alga, Anacystis nidulans.

Documentos Relacionados

• The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.
• The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.
• The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.
• The nucleotide sequence of ribosomal 5S RNA from lettuce seeds.
• The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.