Consensus Termination
Mostrando 1-12 de 108 artigos, teses e dissertações.
-
1. Avaliação dos detectores de defeitos e sua influência nas operações de consenso / On the evaluation of failure detectors and their influence on consensus operations
Este trabalho relata observações e analises sobre como os detectores de defeitos influenciam as operação de consenso. O conceito dos detectores de defeitos é essencial para as operações de consenso em sistemas distribuídos assíncronos, uma vez que esses representam uma das (micas formas de sobrepujar as limitações impostas pela chamada Impossibili
Publicado em: 2010
-
2. Caracterização molecular do gene da β-tubulina em Phakopsora pachyrhizi / Molecular characterization of the β-tubulin gene in Phakopsora pachyrhizi
This study was carried out to characterize either the β- tubulin gene from the Phakopsora pachyrhizi and the protein codified by this gene. The urediniospores were collected in seven Brazilian counties. The genomic DNA was extracted and the β-tubulin gene was amplified by PCR technique through five combinations of specific primers on such a way to
Publicado em: 2008
-
3. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.
Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAA
-
4. MAZ-dependent termination between closely spaced human complement genes.
The zinc finger protein MAZ, originally identified as a factor that binds to the c-myc P2 promoter, is associated with transcriptional termination. As shown in these studies, a termination sequence between the closely spaced human complement genes C2 and Factor B contains a protein binding site which interacts with three different proteins in vitro. Binding
-
5. RNA polymerase II transcription termination is mediated specifically by protein binding to a CCAAT box sequence.
A region in the adenovirus major late promoter (MLP) containing a CCAAT consensus sequence can direct transcription termination of RNA polymerase II, a mechanism that possibly prevents transcriptional interference from upstream genes. Using a chimeric plasmid template that contains the MLP directing expression of the simian virus 40 early region, we showed t
-
6. Impact of the six nucleotides downstream of the stop codon on translation termination
The efficiency of translation termination is influenced by local contexts surrounding stop codons. In Saccharomyces cerevisiae, upstream and downstream sequences act synergistically to influence the translation termination efficiency. By analysing derivatives of a leaky stop codon context, we initially demonstrated that at least six nucleotides after the sto
Oxford University Press.
-
7. Directionality of DnaA protein/DNA interaction. Active orientation of the DnaA protein/dnaA box complex in transcription termination.
The complex of DnaA protein with its 9 bp consensus binding site, the dnaA box 5'-TT(A/T)T(A/C)CA(A/C)A, blocks transcribing RNA polymerase. In a model system, the rate of transcription was monitored distal to the dnaA box 5'-TTTTCCACA by the expression of a reporter gene. DnaA-dependent transcription termination occurred irrespective of whether the dnaA box
-
8. Localisation and characterization of a new rho-dependent transcription terminator from bacteriophage T5.
Relatively few rho-dependent terminators have been described in the literature. This manuscript describes another such terminator, isolated from phage T5. Functional analysis, involving the generation of deletion subclones, has permitted the localization of the terminator on a 413 bp fragment. Attempts to further reduce the size of this fragment resulted in
-
9. Translation of chloroplast-encoded mRNA: potential initiation and termination signals.
A survey of 196 protein-coding chloroplast DNA sequences demonstrated the preference for AUG and UAA codons for initiation and termination of translation, respectively. As in prokaryotes at every nucleotide position from -25 to +25 (AUG is +1 to +3) and for 25 nucleotides 5' and 3' to the termination codon an A or U is predominant, except for C at +5 and G a
-
10. Premature termination of tubulin gene transcription in Xenopus oocytes is due to promoter-dependent disruption of elongation.
We have shown previously that the Xenopus alpha-tubulin gene, X alpha T14, exhibits premature termination of transcription when injected into oocyte nuclei. The 3' ends of prematurely terminated transcripts are formed immediately downstream of a stem-loop sequence found in the first 41 bp of the 5' leader. We show here, using deleted constructs, that prematu
-
11. Nucleotide sequence of a cluster of early and late genes in a conserved segment of the vaccinia virus genome.
The nucleotide sequence of a 7.6 kb vaccinia DNA segment from a genomic region conserved among different orthopox virus has been determined. This segment contains a tight cluster of 12 partly overlapping open reading frames most of which can be correlated with previously identified early and late proteins and mRNAs. Regulatory signals used by vaccinia virus
-
12. Identification of cis Elements Directing Termination of Yeast Nonpolyadenylated snoRNA Transcripts
RNA polymerase II (Pol II) termination is triggered by sequences present in the nascent transcript. Termination of pre-mRNA transcription is coupled to recognition of cis-acting sequences that direct cleavage and polyadenylation of the pre-mRNA. Termination of nonpolyadenylated [non-poly(A)] Pol II transcripts in Saccharomyces cerevisiae requires the RNA-bin
American Society for Microbiology.