Hairpin
Mostrando 1-12 de 1382 artigos, teses e dissertações.
-
1. pGVG: a new Gateway-compatible vector for transformation of sugarcane and other monocot crops
Abstract The successful development of genetically engineered monocots using Agrobacterium-mediated transformation has created an increasing demand for compatible vectors. We have developed a new expression vector, pGVG, for efficient transformation and expression of different constructs for gene overexpression and silencing in sugarcane. The pCAMBIA2300 bin
Genet. Mol. Biol.. Publicado em: 11/06/2018
-
2. Short hairpin RNA targeting insulin-like growth factor binding protein-3 restores the bioavailability of insulin-like growth factor-1 in diabetic rats
ABSTRACT Purpose To investigate whether intracavernosal injection of short hairpin RNA for IGFBP-3 could improve erectile function in streptozotocin-induced diabetic rats. Materials and methods After 12 weeks of IGFBP-3 short hairpin RNA injection treatment, intracavernous pressure responses to electrical stimulation of cavernous nerves were evaluated. T
Int. braz j urol.. Publicado em: 2016-02
-
3. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confir
Braz J Med Biol Res. Publicado em: 14/11/2014
-
4. Targeting PPM1D by lentivirus-mediated RNA interference inhibits the tumorigenicity of bladder cancer cells
Protein phosphatase magnesium/manganese-dependent 1D (PPM1D) is a p53-induced phosphatase that functions as a negative regulator of stress response pathways and has oncogenic properties. However, the functional role ofPPM1D in bladder cancer (BC) remains largely unknown. In the present study, lentivirus vectors carrying small hairpin RNA (shRNA) targeting PP
Braz J Med Biol Res. Publicado em: 23/09/2014
-
5. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro
Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition
Braz J Med Biol Res. Publicado em: 2014-06
-
6. Avaliação de plantas transgênicas de laranja doce (Citrus sinensis) e transformação genética de laranja azeda (Citrus aurantium) para resistência ao Citrus tristeza virus (CTV) / Evaluation of sweet orange (Citrus sinensis) transgenic plants and genetic transformation of sour orange (Citrus aurantium) for the resistance to Citrus tristeza virus (CTV)
Citrus tristeza virus (CTV) ocorre em quase todas as áreas produtoras de citros do mundo. O controle da doença se baseia, principalmente, no uso de porta-enxertos tolerantes e na premunização das copas. A obtenção de copas de laranjas doces ou de porta-enxerto de laranja azeda transgênicos resistentes ao CTV permitiria retornar a um uso mais intensivo
IBICT - Instituto Brasileiro de Informação em Ciência e Tecnologia. Publicado em: 25/05/2012
-
7. Micro RNA em adenocarcinoma de próstata: caracterização da expressão em tumores de baixo grau, órgão-confinados / Micro RNA in prostate adenocarcinoma : characterization of expression in low-grade tumors, organ-confined tumours
Introdução: Os micro RNA (miRNA) são formados a partir de RNA precursores de fita dupla que contém entre 60 a 110 nucleotídeos e formam estruturas do tipo hairpin. Imediatamente após sua transcrição pela RNA polimerase II a enzima Dicer promove a clivagem do RNA precursor em seqüências menores contendo 19 a 22 nucleotídeos. Após a clivagem, o miR
IBICT - Instituto Brasileiro de Informação em Ciência e Tecnologia. Publicado em: 18/11/2011
-
8. Organization and variation of mitochondrial DNA control region in pleurodiran turtles
Three complete mitochondrial DNA (mtDNA) control regions (CRs) of Chelodina rugosa (Ogilby, 1890), Chelus fimbriata (Schneider, 1783), and Podocnemis unifilis (Troschel, 1848) were firstly determined using Long-PCR method and the length were 1,016 bp, 1,149 bp, and 985bp, respectively. Together with CRs of Pelomedusa subrufa (Bonnaterre, 1789) and nearly com
Zoologia (Curitiba). Publicado em: 2011-08
-
9. The perspective for the use of genetically modified common beans in Brazil based on genetic diversity of Bean golden mosaic virus.
Bean golden mosaic is the most important viral disease affecting common beans (Phaseolus vulgaris) in Brazil. It is caused by Bean golden mosaic virus (BGMV) and is prevalent in all bean producing areas. Aiming to control the disease, a transgenic bean elite line was developed with an intron-hairpin construction to silence the AC1 viral gene. This line shows
INTERNATIONAL GEMINIVIRUS SYMPOSIUM. Publicado em: 2011
-
10. Avaliação da via do hedgehog nas hepatites crônicas B e C : da fibrose zero até a cirrose associada ou não ao carcinoma hepatocelular
Ativação da via do Hedgehog (Hh) promove vários processos que ocorrem durante o reparo fibrogênico hepático. O papel da via do Hh na lesão causada pela hepatite crônica B e C ainda não foi investigado. Estudos de expressão global em carcinomas hepatocelulares (CHC) demostraram a ativação da via do Hh em pacientes com CHC relacionados à infecção
IBICT - Instituto Brasileiro de Informação em Ciência e Tecnologia. Publicado em: 17/03/2010
-
11. Transformação genética de maracujazeiro azedo para resistência ao vírus do endurecimento dos frutos (Cowpea aphid-borne mosaic virus - CABMV) / Genetic transformation of yellow passionfruit for resistance to woodiness virus (Cowpea aphid-borne mosaic virus CABMV)
A cultura do maracujazeiro é afetada pela virose causada pelo Cowpea aphid-borne mosaic virus (CABMV), provocando a redução da qualidade e produtividade dos frutos e, em alguns casos, pode inviabilizar o cultivo comercial desta espécie. Uma alternativa para o controle de doenças viróticas é o desenvolvimento de plantas resistentes pela transformação
Publicado em: 2010
-
12. Transformação genética de maracujazeiro (Passiflora alata Curtis) para resistência ao Cowpea aphid-borne mosaic virus (CABMV) / Genetic transformation of passionflower (Passiflora alata Curtis) for resistance to Cowpea aphid-borne mosaic virus (CABMV)
Uma das espécies que atualmente vem despertando interesse econômico por seu elevado valor de mercado é o maracuzajeiro doce (Passiflora alata Curtis). Entretanto, a cultura é afetada por diferentes doenças que prejudicam a produtividade e a qualidade dos frutos, sendo a doença causada pelo Cowpea aphid-borne mosaic virus (CABMV) a que mais afeta a cult
Publicado em: 2010