Ifn Y
Mostrando 1-12 de 183 artigos, teses e dissertações.
-
1. Sambucus australis Modulates Inflammatory Response via Inhibition of Nuclear Factor Kappa B (NF-kB) in vitro
Abstract: Medicinal plants have long been used as an alternative to traditional drugs for the treatment of inflammatory conditions due to the classical side effects and restricted access of various commercially available drugs, such as steroids (GCs) and nonsteroidal anti-inflammatory drugs (NSAIDs). Sambucus australis is a Brazilian herb that is commonly us
An. Acad. Bras. Ciênc.. Publicado em: 21/03/2019
-
2. Benznidazole affects expression of Th1, Th17 and Treg cytokines during acute experimental Trypanosoma cruzi infection
Abstract Background The present study evaluated the effect of treatment with benznidazole on mRNA expression of IFN-γ, IL-17, IL-10, TGF-β and FoxP3 in spleen and heart tissue of BALB/c mice in the acute phase of an experimental infection with Trypanosoma cruzi, strains JLP or Y. Methods The mRNA expression of cytokines and parasite load were assessed by
J. Venom. Anim. Toxins incl. Trop. Dis. Publicado em: 01/02/2018
-
3. Humoral and cellular immune response of mice challenged with Yersinia pestis antigenic preparations
ABSTRACT Objectives: The plague, which is an infectious disease caused by Yersinia pestis, still threatens many populations in several countries. The worldwide increase in human plague cases and the potential use of the bacteria as a biological weapon reinforce the need to study the immunity that is induced by potential vaccine candidates. To determine the
Braz J Infect Dis. Publicado em: 2017-12
-
4. Antidepressant effects of Kai-Xin-San in fluoxetine-resistant depression rats
This study aimed to investigate the antidepressant effect and the mechanism of action of Kai-Xin-San (KXS) in fluoxetine-resistant depressive (FRD) rats. Two hundred male Wistar rats weighing 200±10 g were exposed to chronic and unpredictable mild stresses (CUMS) for 4 weeks and given fluoxetine treatment simultaneously. The rats that did not show significa
Braz J Med Biol Res. Publicado em: 17/08/2017
-
5. Tangeretin has anti-asthmatic effects via regulating PI3K and Notch signaling and modulating Th1/Th2/Th17 cytokine balance in neonatal asthmatic mice
Asthma is a chronic allergic disease characterized by airway inflammation, airway hyper-responsiveness (AHR), and mucus hypersecretion. T-lymphocytes are involved in the pathogenesis of asthma, mediating airway inflammatory reactions by secreting cytokines. The phosphoinositide 3-kinase (PI3K) and Notch signaling pathways are associated with T cell signaling
Braz J Med Biol Res. Publicado em: 20/07/2017
-
6. Cytokine expression patterns and mesenchymal stem cell karyotypes from the bone marrow microenvironment of patients with myelodysplastic syndromes
The purpose of this study was to explore cytokine expression patterns and cytogenetic abnormalities of mesenchymal stem cells (MSCs) from the bone marrow microenvironment of Chinese patients with myelodysplastic syndromes (MDS). Bone marrow samples were obtained from 30 cases of MDS (MDS group) and 30 healthy donors (control group). The expression pattern of
Braz J Med Biol Res. Publicado em: 20/01/2015
-
7. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confir
Braz J Med Biol Res. Publicado em: 14/11/2014
-
8. Quantificação de citocinas no soro e homogenato da pata na intoxicação experimental com veneno de Bothropoides jararaca em ratos Wistar tratados com soroterapia e Mikania glomerata
O presente estudo teve como objetivo quantificar os níveis de citocinas pró-inflamatórias, entre as quais TNF-α, interleucina-1β (IL-1β), IL-6, e anti-inflamatórias, como IL-10, interferon-γ (INF-γ), bem como comparar o efeito do tratamento convencional com o efeito do tratamento complementado pelo extrato da planta Mikania glomerata, na intoxicaç�
Arq. Bras. Med. Vet. Zootec.. Publicado em: 2014-10
-
9. Perfil de citocinas IL-2, IL-4, IL-10, IFN-?, TNF-? e células KC-like em cadelas gestantes
Objetivou-se por meio deste estudo determinar o perfil das citocinas IL-2, IL-4, IL-10, IFN-γ, TNF-α e células KC-like (natural killer) em cadelas gestantes, valores que são inéditos para a espécie. Foram utilizadas 27 fêmeas das raças Shi-tzu, Pug, Bulldog Inglês e Francês, pesando de 4 a 20 kg e com idade entre quatro e seis anos. Foram coletadas
Arq. Bras. Med. Vet. Zootec.. Publicado em: 2014-08
-
10. Deteccao de citocinas no diagnostico de pacientes alergicos ao cromo
FUNDAMENTOS: O teste de contato permanece como padrão ouro para a identificação do agente causal da dermatite de contato alérgica, mas é um exame subjetivo, que demanda considerável tempo do paciente e do medico, exige cuidados na sua técnica e apresenta algumas contra-indicações que dificultam o seu uso. Em um estudo recente demonstramos que o te
An. Bras. Dermatol.. Publicado em: 2013-10
-
11. Tratamento com inibidor da Rho quinase em cobais com inflamação pulmonar alérgica crônica: modulação da inflamação eosinofílica, da expressão de citocinas inflamatórias, da matriz extracelular e do estresse oxidativo no parênquima pulmonar / Treatment with Rho-kinase inhibitor in guinea pigs with chronic allergic inflammation: modulation of eosinophilic inflammation, expression of inflammatory cytokines, extracellular matrix and oxidative stress in lung tissue
RATIONALE: Previous studies with Rho-kinase inhibitors suggest a beneficial influence of these drugs in asthma. The relevance of distal lung tissue in functional asthmatic impairment has been intensely emphasized. There have not been any previous studies evaluating the effects of these inhibitors on the modulation of distal lung mechanics and histopathologic
IBICT - Instituto Brasileiro de Informação em Ciência e Tecnologia. Publicado em: 18/12/2012
-
12. Effects of zinc and L-arginine administration during pregnancy of Wistar rats infected with the Y strain of Trypanosoma cruzi. / Efeitos da administração de Zinco e L-arginina na prenhez de ratos Wistar infectados pela cepa Y de Trypanosoma cruzi
O zinco é um elemento de grande importância para o desenvolvimento intra-uterino e é usado durante a gravidez para auxiliar o crescimento fetal. A arginina, um aminoácido dibásico, além de ser necessário para o crescimento, apresenta importantes funções biológicas e fisiológicas. Alguns autores mostraram que a ingestão de arginina melhora a respo
IBICT - Instituto Brasileiro de Informação em Ciência e Tecnologia. Publicado em: 17/08/2012